Protein Synthes Poster Project:  A Quiz Grade Due Tuesday Before Finals. (EOP)

1. You will make a poster, and you can work alone, or with one partner.

2. The poster will represent the process of protein synthesis.

3. Show transcription, in the nucleus, and translation at the ribosome.

4. Label the nucleus, transcription, translation, nuclear membrane, ribosome, DNA, mRNA, tRNA, RNA polymerase, amino acids, final protein and any structure that has a part in the overall process.

5. You will use a 'gene' that has the DNA code of AUGCGCGGAUCCCCCACCUGA and show how that changes into mRNA code, and then show what amino acids it produces.

*Use this DNA code, or the one given in class. Label your project as DNA code 2 if you use the internet version of code...either one will be OK.

Return to Biology Menu